![]() |
![]() |
|
Show/Hide Help
|
|
I have a database of siRNAs. How can I link to siRNA-Check to show that target location of each siRNA and known splice variants? |
The best way to do this is to use the Batch siRNA-Check utility. 1. Create a fasta file that has the sequence of ALL of your siRNAs. The header of each sequence should be some unique name/id for the siRNA. For example: >mysi1234 ACGGATGAGCATGGCCTTGTA >mysi5678 CACCAACTCAAAGATTCGTAA The id should be something you have in your database that uniquely identifies each siRNA. 2. Submit this file to Batch siRNA-Check 3. The batch siRNA-Check will e-mail you a zip file with two reports. The report with a name that ends in "_siRNA.csv" will contain information about each siRNA. The first column has the ID that you provided in the fasta header. There is one row per siRNA you submitted. The output shows the gene targeted by the siRNA, the exon that is targeted, and the chromosomal location of the target sequence. The report also has a URL that will bring up a graphic in SpliceCenter with the target location of the siRNA mapped to all known splice variants. 4. You can load the information from this report into a local database so that you can add a link to the SpliceCenter URL for each siRNA to your database. |
Have a question about siRNA-Check? |
| Send us an email at binf@tigerteamit.com! |